Transcript: Mouse NM_011263.2

Mus musculus RE1-silencing transcription factor (Rest), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Rest (19712)
Length:
4266
CDS:
305..3553

Additional Resources:

NCBI RefSeq record:
NM_011263.2
NBCI Gene record:
Rest (19712)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_011263.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000321485 GAAATATACAGCGCCAATAAA pLKO_005 683 CDS 100% 15.000 21.000 N Rest n/a
2 TRCN0000321488 GTGTAATCTACAATACCATTT pLKO_005 1492 CDS 100% 10.800 15.120 N Rest n/a
3 TRCN0000071345 CGCCCGTATAAATGTGAACTT pLKO.1 1193 CDS 100% 4.950 6.930 N Rest n/a
4 TRCN0000071343 CGCGGCTTCTAAGAAGTGTAA pLKO.1 1477 CDS 100% 4.950 6.930 N Rest n/a
5 TRCN0000071344 CCAGAAATATACAGCGCCAAT pLKO.1 680 CDS 100% 4.050 5.670 N Rest n/a
6 TRCN0000321484 ACGGGCCTAAACCTCTTAATT pLKO_005 1356 CDS 100% 15.000 12.000 N Rest n/a
7 TRCN0000321416 ACAGGAGAACGCCCGTATAAA pLKO_005 1184 CDS 100% 15.000 10.500 N Rest n/a
8 TRCN0000071346 CCCAAGACAAAGACAAGTAAA pLKO.1 2066 CDS 100% 13.200 9.240 N Rest n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_011263.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.