Transcript: Mouse NM_011283.2

Mus musculus retinitis pigmentosa 1 (human) (Rp1), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Rp1 (19888)
Length:
7508
CDS:
128..6415

Additional Resources:

NCBI RefSeq record:
NM_011283.2
NBCI Gene record:
Rp1 (19888)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_011283.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000105690 CCCTAATGAGTGGGATGATTT pLKO.1 6440 3UTR 100% 13.200 18.480 N Rp1 n/a
2 TRCN0000105693 CCCTAGCAGTTGGACAGATAA pLKO.1 6154 CDS 100% 13.200 18.480 N Rp1 n/a
3 TRCN0000105692 CGCCATTCAAATATCACTCAT pLKO.1 197 CDS 100% 4.950 6.930 N Rp1 n/a
4 TRCN0000105694 GCACTGATGATCTGGAATCAA pLKO.1 4095 CDS 100% 5.625 3.938 N Rp1 n/a
5 TRCN0000105691 CCTGAGAATTACTTGGCCTTA pLKO.1 1016 CDS 100% 4.050 2.835 N Rp1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_011283.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.