Transcript: Mouse NM_011321.3

Mus musculus spermine binding protein (Sbp), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Sbp (20234)
Length:
839
CDS:
78..677

Additional Resources:

NCBI RefSeq record:
NM_011321.3
NBCI Gene record:
Sbp (20234)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_011321.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000183658 CCTTTATCTCTCTGTCTAATA pLKO.1 800 3UTR 100% 13.200 9.240 N Sbp n/a
2 TRCN0000179585 GCCTTTATCTCTCTGTCTAAT pLKO.1 799 3UTR 100% 13.200 9.240 N Sbp n/a
3 TRCN0000179709 GATGCTGACAACAAAGATGAT pLKO.1 603 CDS 100% 4.950 3.465 N Sbp n/a
4 TRCN0000180038 CAGTAACTGGACTGATGTCTA pLKO.1 257 CDS 100% 4.950 2.970 N Sbp n/a
5 TRCN0000255329 AGGACGGAGAGCACGTGATAA pLKO_005 316 CDS 100% 13.200 6.600 Y Sbpl n/a
6 TRCN0000255327 GAATGCTGCTGGCAAGTATTT pLKO_005 143 CDS 100% 13.200 6.600 Y Sbpl n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_011321.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.