Transcript: Mouse NM_011347.2

Mus musculus selectin, platelet (Selp), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Selp (20344)
Length:
3438
CDS:
124..2430

Additional Resources:

NCBI RefSeq record:
NM_011347.2
NBCI Gene record:
Selp (20344)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_011347.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000066771 GACCGGAAAGACTGGATTGTT pLKO.1 1580 CDS 100% 5.625 4.500 N Selp n/a
2 TRCN0000066769 CCTAGGAACATACGGAGTCTT pLKO.1 2379 CDS 100% 4.950 3.960 N Selp n/a
3 TRCN0000066772 GCTTCTGGGATCTGGACAAAT pLKO.1 859 CDS 100% 13.200 9.240 N Selp n/a
4 TRCN0000066770 CCATCCAGAATAAGAATGAAA pLKO.1 329 CDS 100% 5.625 3.938 N Selp n/a
5 TRCN0000066768 CCCAACAACAAGAAGAACAAT pLKO.1 487 CDS 100% 5.625 3.938 N Selp n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_011347.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.