Transcript: Mouse NM_011353.2

Mus musculus small EDRK-rich factor 1 (Serf1), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Serf1 (20365)
Length:
610
CDS:
205..393

Additional Resources:

NCBI RefSeq record:
NM_011353.2
NBCI Gene record:
Serf1 (20365)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_011353.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000177112 GCATCATACGCTCTAAGATTA pLKO.1 436 3UTR 100% 13.200 18.480 N Serf1 n/a
2 TRCN0000340724 GCATCATACGCTCTAAGATTA pLKO_005 436 3UTR 100% 13.200 18.480 N Serf1 n/a
3 TRCN0000198229 GTGCATCATACGCTCTAAGAT pLKO.1 434 3UTR 100% 5.625 7.875 N Serf1 n/a
4 TRCN0000340651 AGAGAAATTGCCCGACAGAAA pLKO_005 223 CDS 100% 4.950 6.930 N Serf1 n/a
5 TRCN0000197745 GCCAATGAGAAGAAATCTATG pLKO.1 355 CDS 100% 10.800 7.560 N Serf1 n/a
6 TRCN0000177029 GAAATCTATGCAGACAACAGA pLKO.1 366 CDS 100% 3.000 2.100 N Serf1 n/a
7 TRCN0000340649 GAAATCTATGCAGACAACAGA pLKO_005 366 CDS 100% 3.000 2.100 N Serf1 n/a
8 TRCN0000178575 CCAGGAAATTAGCAAAGGGAA pLKO.1 258 CDS 100% 2.640 1.848 N Serf1 n/a
9 TRCN0000181545 GAAAGCAGAGGGATTCAGAGA pLKO.1 311 CDS 100% 2.640 1.848 N Serf1 n/a
10 TRCN0000181437 CTCAGAGAAAGCAGAGGGATT pLKO.1 305 CDS 100% 4.050 2.430 N Serf1 n/a
11 TRCN0000340648 CTCAGAGAAAGCAGAGGGATT pLKO_005 305 CDS 100% 4.050 2.430 N Serf1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_011353.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.