Transcript: Mouse NM_011366.3

Mus musculus sorbin and SH3 domain containing 3 (Sorbs3), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Sorbs3 (20410)
Length:
2948
CDS:
45..2246

Additional Resources:

NCBI RefSeq record:
NM_011366.3
NBCI Gene record:
Sorbs3 (20410)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_011366.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000434738 GTCACCTCCGAACCCATATAG pLKO_005 250 CDS 100% 13.200 18.480 N Sorbs3 n/a
2 TRCN0000112959 CGAACTAGAAACTGGGCATAA pLKO.1 959 CDS 100% 10.800 8.640 N Sorbs3 n/a
3 TRCN0000123146 TGGCTCCAACACCCTTAATTT pLKO.1 314 CDS 100% 15.000 10.500 N SORBS3 n/a
4 TRCN0000112956 CGAAGAATGTTCCAGCAAATT pLKO.1 633 CDS 100% 13.200 9.240 N Sorbs3 n/a
5 TRCN0000431306 CTTTCTGGGACGTAGAGATTT pLKO_005 1283 CDS 100% 13.200 9.240 N Sorbs3 n/a
6 TRCN0000112957 GCTTCGTCTTTGAACAACAAA pLKO.1 78 CDS 100% 5.625 3.938 N Sorbs3 n/a
7 TRCN0000112958 CCAGCTAATTATGTGGAGGTT pLKO.1 1524 CDS 100% 2.640 1.848 N Sorbs3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_011366.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.