Transcript: Mouse NM_011385.2

Mus musculus ski sarcoma viral oncogene homolog (avian) (Ski), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Ski (20481)
Length:
5481
CDS:
16..2199

Additional Resources:

NCBI RefSeq record:
NM_011385.2
NBCI Gene record:
Ski (20481)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_011385.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000042567 GATCCTCAAAGTCATGGGCAT pLKO.1 492 CDS 100% 2.160 3.024 N Ski n/a
2 TRCN0000042566 CGTGAAGGAGAAGTTCGACTA pLKO.1 933 CDS 100% 4.050 3.240 N Ski n/a
3 TRCN0000039712 AGACAGCTTCTACTCCTACAA pLKO.1 1218 CDS 100% 4.950 3.465 N SKI n/a
4 TRCN0000039711 GCTGGAGATCCTCAAAGTCAT pLKO.1 486 CDS 100% 4.950 3.465 N SKI n/a
5 TRCN0000042564 CCAGCTTCCATAAGACCCAAA pLKO.1 997 CDS 100% 4.050 2.835 N Ski n/a
6 TRCN0000042565 CCTGGATACTAAGGAAGCCAA pLKO.1 1668 CDS 100% 2.640 1.848 N Ski n/a
7 TRCN0000235447 ACGAGTGCTTCGGCAAGTGTA pLKO_005 680 CDS 100% 4.950 6.930 N SKI n/a
8 TRCN0000166364 CACACACACACACACACACAA pLKO.1 4763 3UTR 100% 4.950 2.475 Y KAAG1 n/a
9 TRCN0000178741 CACACACATACACACACACAA pLKO.1 4753 3UTR 100% 4.950 2.475 Y Cstad n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_011385.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.