Transcript: Mouse NM_011404.3

Mus musculus solute carrier family 7 (cationic amino acid transporter, y+ system), member 5 (Slc7a5), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Slc7a5 (20539)
Length:
3513
CDS:
81..1619

Additional Resources:

NCBI RefSeq record:
NM_011404.3
NBCI Gene record:
Slc7a5 (20539)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_011404.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000079395 GCGCAATATCACGCTGCTCAA pLKO.1 224 CDS 100% 4.050 5.670 N Slc7a5 n/a
2 TRCN0000060272 GCTCTGGATCGAGCTGCTCAT pLKO.1 479 CDS 100% 1.350 1.890 N SLC7A5P2 n/a
3 TRCN0000079397 CGGAGGATGGAACTATCTGAA pLKO.1 857 CDS 100% 4.950 3.960 N Slc7a5 n/a
4 TRCN0000426198 GGATCGAGCTGCTCATCATTC pLKO_005 484 CDS 100% 10.800 7.560 N Slc7a5 n/a
5 TRCN0000443348 GTGTCATGTCCTGGATCATTC pLKO_005 1057 CDS 100% 10.800 7.560 N Slc7a5 n/a
6 TRCN0000430517 TGTGAACTGCTACAGCGTAAA pLKO_005 635 CDS 100% 10.800 7.560 N Slc7a5 n/a
7 TRCN0000079394 CCTATTTCACTACCCTCTCTA pLKO.1 979 CDS 100% 4.950 3.465 N Slc7a5 n/a
8 TRCN0000079393 CCTGAGATAGTGCTGTGGTTA pLKO.1 3350 3UTR 100% 4.950 3.465 N Slc7a5 n/a
9 TRCN0000059820 CGCCTTCCTCAAGCTCTGGAT pLKO.1 467 CDS 100% 0.880 0.616 N SLC7A5P1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_011404.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.