Transcript: Mouse NM_011409.1

Mus musculus schlafen 3 (Slfn3), mRNA.

Source:
NCBI, updated 2017-04-25
Taxon:
Mus musculus (mouse)
Gene:
Slfn3 (20557)
Length:
1834
CDS:
210..1763

Additional Resources:

NCBI RefSeq record:
NM_011409.1
NBCI Gene record:
Slfn3 (20557)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_011409.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000321233 ATCCAGGACAGATCCCGAAGA pLKO_005 560 CDS 100% 4.050 5.670 N Slfn3 n/a
2 TRCN0000271126 CTCAATCTCAGATGAAGTGAA pLKO_005 512 CDS 100% 4.950 3.465 N Slfn3 n/a
3 TRCN0000077444 GATCCCGAAGAGAAAGCAGAA pLKO.1 570 CDS 100% 4.050 2.835 N Slfn3 n/a
4 TRCN0000077446 CGTCTGTAATGAAACACTAAA pLKO.1 617 CDS 100% 13.200 7.920 N Slfn3 n/a
5 TRCN0000271177 GCTGTCCAGAAGCCCTCTATA pLKO_005 1171 CDS 100% 13.200 7.920 N Slfn3 n/a
6 TRCN0000271176 TACAGAAGAATCAACTCAATC pLKO_005 498 CDS 100% 10.800 6.480 N Slfn3 n/a
7 TRCN0000077445 CGTTGAAATCTTAGGAAGTTA pLKO.1 1643 CDS 100% 5.625 3.375 N Slfn3 n/a
8 TRCN0000271178 AGCAGAATCCAGACCAAGTTC pLKO_005 584 CDS 100% 4.950 2.970 N Slfn3 n/a
9 TRCN0000077447 CCTAACATTAAAGCAGATGTT pLKO.1 1463 CDS 100% 0.495 0.297 N Slfn3 n/a
10 TRCN0000077443 GCCGAGTTAAAGGGCTATTAT pLKO.1 1431 CDS 100% 15.000 7.500 Y Slfn3 n/a
11 TRCN0000088044 GCGCCGAGTTAAAGGGCTATT pLKO.1 1429 CDS 100% 10.800 5.400 Y Slfn4 n/a
12 TRCN0000088046 CTTAGGAAGTTATGAGTCTTT pLKO.1 1652 CDS 100% 4.950 2.475 Y Slfn4 n/a
13 TRCN0000088047 TCTTAGGAAGTTATGAGTCTT pLKO.1 1651 CDS 100% 4.950 2.475 Y Slfn4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_011409.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.