Transcript: Mouse NM_011471.2

Mus musculus small proline-rich protein 2E (Sprr2e), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Sprr2e (20759)
Length:
647
CDS:
62..292

Additional Resources:

NCBI RefSeq record:
NM_011471.2
NBCI Gene record:
Sprr2e (20759)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_011471.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000191872 GCTGATTATATGTTCTCAAGT pLKO.1 488 3UTR 100% 4.950 3.960 N Sprr2e n/a
2 TRCN0000201841 GTCACTCCCATTTGCCTGTAA pLKO.1 407 3UTR 100% 4.950 3.960 N Sprr2e n/a
3 TRCN0000191103 GAAGAGAATCTATCTCATGTA pLKO.1 325 3UTR 100% 4.950 2.475 Y Sprr2e n/a
4 TRCN0000191478 GAGAATCTATCTCATGTACTT pLKO.1 328 3UTR 100% 4.950 2.475 Y Sprr2e n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_011471.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.