Transcript: Mouse NM_011472.2

Mus musculus small proline-rich protein 2F (Sprr2f), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Sprr2f (20760)
Length:
609
CDS:
63..293

Additional Resources:

NCBI RefSeq record:
NM_011472.2
NBCI Gene record:
Sprr2f (20760)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_011472.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000249623 TCTCAGTGATGACCTCTAATA pLKO_005 429 3UTR 100% 13.200 9.240 N Sprr2f n/a
2 TRCN0000249624 CATTCCATAGCAACACCTTAT pLKO_005 346 3UTR 100% 10.800 7.560 N Sprr2f n/a
3 TRCN0000249626 TCTCTACCCTTCACCTACTTC pLKO_005 404 3UTR 100% 4.950 3.465 N Sprr2f n/a
4 TRCN0000184768 CCTCCAAAGTCTGACATGGAT pLKO.1 371 3UTR 100% 3.000 2.100 N Sprr2f n/a
5 TRCN0000183972 CTCCCTCATTCCAGCAGAAAT pLKO.1 214 CDS 100% 13.200 7.920 N Sprr2f n/a
6 TRCN0000179528 GACATGGATGCAGAAGAATTT pLKO.1 383 3UTR 100% 13.200 7.920 N Sprr2f n/a
7 TRCN0000249625 AGTGAAGTCTTCAGCAGTCTT pLKO_005 289 CDS 100% 4.950 2.970 N Sprr2f n/a
8 TRCN0000249627 AGTCTGACATGGATGCAGAAG pLKO_005 378 3UTR 100% 4.050 2.430 N Sprr2f n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_011472.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.