Transcript: Mouse NM_011517.2

Mus musculus synaptonemal complex protein 3 (Sycp3), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Sycp3 (20962)
Length:
1132
CDS:
80..844

Additional Resources:

NCBI RefSeq record:
NM_011517.2
NBCI Gene record:
Sycp3 (20962)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_011517.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000434482 GAATATTCTCAGCAATTTATG pLKO_005 503 CDS 100% 13.200 18.480 N Sycp3 n/a
2 TRCN0000123992 GCCGCTGAGCAAACATCTAAA pLKO.1 118 CDS 100% 13.200 18.480 N Sycp3 n/a
3 TRCN0000123991 GCTCCAGTAATTGATAAACAT pLKO.1 275 CDS 100% 5.625 7.875 N Sycp3 n/a
4 TRCN0000123990 CGAGCAGTTCATAAAGAGTTT pLKO.1 670 CDS 100% 4.950 6.930 N Sycp3 n/a
5 TRCN0000429357 GGCACACAAAGTGAACTTAAA pLKO_005 728 CDS 100% 13.200 9.240 N Sycp3 n/a
6 TRCN0000123989 GAGTCTTTGAAGAAAGAACTT pLKO.1 846 3UTR 100% 0.495 0.248 Y Sycp3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_011517.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.