Transcript: Mouse NM_011578.4

Mus musculus transforming growth factor, beta receptor III (Tgfbr3), mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Tgfbr3 (21814)
Length:
6090
CDS:
466..3018

Additional Resources:

NCBI RefSeq record:
NM_011578.4
NBCI Gene record:
Tgfbr3 (21814)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_011578.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000348378 CTTACCACGGCCCACGTAAAT pLKO_005 3186 3UTR 100% 13.200 18.480 N Tgfbr3 n/a
2 TRCN0000348377 GCACCTTCCAGGTGGATATAA pLKO_005 1208 CDS 100% 15.000 12.000 N Tgfbr3 n/a
3 TRCN0000348460 GTGGTTTACTATAACTCTATT pLKO_005 2011 CDS 100% 13.200 10.560 N Tgfbr3 n/a
4 TRCN0000348459 AGATTTGGAGTCGGGTGATAA pLKO_005 2085 CDS 100% 13.200 9.240 N Tgfbr3 n/a
5 TRCN0000065834 GCAGAGAATGAGCATGTATAT pLKO.1 2302 CDS 100% 13.200 9.240 N Tgfbr3 n/a
6 TRCN0000334910 GCAGAGAATGAGCATGTATAT pLKO_005 2302 CDS 100% 13.200 9.240 N Tgfbr3 n/a
7 TRCN0000065833 CCCTGTAAAGAGAGAGTGAAT pLKO.1 3129 3UTR 100% 4.950 3.465 N Tgfbr3 n/a
8 TRCN0000065835 CCCACGTGTAACATAGGGAAA pLKO.1 1054 CDS 100% 4.050 2.835 N Tgfbr3 n/a
9 TRCN0000065836 GCTGTATAACACAGACCTCTT pLKO.1 2250 CDS 100% 4.050 2.835 N Tgfbr3 n/a
10 TRCN0000065837 GCTTGAGAACAACGAGGAGAT pLKO.1 1533 CDS 100% 4.050 2.835 N Tgfbr3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_011578.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.