Transcript: Mouse NM_011606.2

Mus musculus C-type lectin domain family 3, member b (Clec3b), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Clec3b (21922)
Length:
1009
CDS:
99..707

Additional Resources:

NCBI RefSeq record:
NM_011606.2
NBCI Gene record:
Clec3b (21922)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_011606.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000119433 CCGCGATCAGTTGCCCTACAT pLKO.1 665 CDS 100% 1.650 2.310 N Clec3b n/a
2 TRCN0000371799 CAACGGCAAGTGGTTCGACAA pLKO_005 638 CDS 100% 4.050 2.835 N CLEC3B n/a
3 TRCN0000119432 CACAAAGAGCAGAAGGCTGTT pLKO.1 772 3UTR 100% 4.050 2.835 N Clec3b n/a
4 TRCN0000119436 CTTACAGACTGTGTGCCTGAA pLKO.1 296 CDS 100% 4.050 2.835 N Clec3b n/a
5 TRCN0000119435 GCTGCAAATGCCAAGAAAGAT pLKO.1 189 CDS 100% 5.625 3.375 N Clec3b n/a
6 TRCN0000062476 GCCTACAAGAACTGGGAGACT pLKO.1 555 CDS 100% 2.640 1.848 N CLEC3B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_011606.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.