Transcript: Mouse NM_011636.2

Mus musculus phospholipid scramblase 1 (Plscr1), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Plscr1 (22038)
Length:
2141
CDS:
182..1168

Additional Resources:

NCBI RefSeq record:
NM_011636.2
NBCI Gene record:
Plscr1 (22038)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_011636.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000105045 GCTCCCAAATTAGAGTTTATT pLKO.1 1325 3UTR 100% 15.000 10.500 N Plscr1 n/a
2 TRCN0000105048 CCTTCACGGATGCAGACAATT pLKO.1 1017 CDS 100% 13.200 9.240 N Plscr1 n/a
3 TRCN0000316696 CCTTCACGGATGCAGACAATT pLKO_005 1017 CDS 100% 13.200 9.240 N Plscr1 n/a
4 TRCN0000105046 GCTGGAATACTTAGCTCAGAT pLKO.1 502 CDS 100% 4.950 3.465 N Plscr1 n/a
5 TRCN0000349195 GCTGGAATACTTAGCTCAGAT pLKO_005 502 CDS 100% 4.950 3.465 N Plscr1 n/a
6 TRCN0000105049 AGCTTCTGGTTCATCAGCAAA pLKO.1 528 CDS 100% 4.950 2.970 N Plscr1 n/a
7 TRCN0000316768 AGCTTCTGGTTCATCAGCAAA pLKO_005 528 CDS 100% 4.950 2.970 N Plscr1 n/a
8 TRCN0000105047 GCTTGGTGCTTGTTTCCTCAT pLKO.1 1087 CDS 100% 4.050 2.430 N Plscr1 n/a
9 TRCN0000316769 GCTTGGTGCTTGTTTCCTCAT pLKO_005 1087 CDS 100% 4.050 2.430 N Plscr1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_011636.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.