Transcript: Mouse NM_011638.4

Mus musculus transferrin receptor (Tfrc), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Tfrc (22042)
Length:
4920
CDS:
165..2456

Additional Resources:

NCBI RefSeq record:
NM_011638.4
NBCI Gene record:
Tfrc (22042)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_011638.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000375693 AGAGTCTCCTTTCCGACATAT pLKO_005 2252 CDS 100% 13.200 18.480 N Tfrc n/a
2 TRCN0000032254 CGTATTATGAAAGTGGAGTAT pLKO.1 2202 CDS 100% 4.950 6.930 N Tfrc n/a
3 TRCN0000032256 CGTTGAATTGAACCTGGACTA pLKO.1 1985 CDS 100% 4.050 5.670 N Tfrc n/a
4 TRCN0000375694 ATTCTACCCAATCATCTAATG pLKO_005 2555 3UTR 100% 10.800 8.640 N Tfrc n/a
5 TRCN0000348832 CCTACATCATCTCGCTTATAT pLKO_005 519 CDS 100% 15.000 10.500 N Tfrc n/a
6 TRCN0000348896 GATGAAAGTCTTGCCTATTAT pLKO_005 654 CDS 100% 15.000 10.500 N Tfrc n/a
7 TRCN0000032258 CCAGACCGTTATGTTGTAGTA pLKO.1 1365 CDS 100% 4.950 3.465 N Tfrc n/a
8 TRCN0000032257 CCGACAATAACATGAAGGCTA pLKO.1 307 CDS 100% 2.640 1.848 N Tfrc n/a
9 TRCN0000375695 GTGATATCTTCTCAGATTATC pLKO_005 2647 3UTR 100% 13.200 7.920 N Tfrc n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_011638.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.