Transcript: Mouse NM_011683.2

Mus musculus vomeronasal 1 receptor 51 (Vmn1r51), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Vmn1r51 (22296)
Length:
2359
CDS:
818..1807

Additional Resources:

NCBI RefSeq record:
NM_011683.2
NBCI Gene record:
Vmn1r51 (22296)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_011683.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000042729 GCGTAAATCTCTCCATCATAT pLKO.1 1270 CDS 100% 13.200 18.480 N Vmn1r51 n/a
2 TRCN0000042731 ACTGGTCATCAGGGATGTCTT pLKO.1 1459 CDS 100% 4.950 3.465 N Vmn1r51 n/a
3 TRCN0000042732 TCATTCTAACTTAAGGCACAT pLKO.1 922 CDS 100% 4.050 2.835 N Vmn1r51 n/a
4 TRCN0000042728 CCAACATCTTACAATATGCAA pLKO.1 1697 CDS 100% 3.000 2.100 N Vmn1r51 n/a
5 TRCN0000042730 CCTACTAATGCTACTGGTCAT pLKO.1 1072 CDS 100% 4.050 2.430 N Vmn1r51 n/a
6 TRCN0000120239 CCTTTGTACCACCAGCATGTT pLKO.1 1192 CDS 100% 4.950 2.475 Y Vmn1r48 n/a
7 TRCN0000075658 GCTCTATTCTACCCTTGAGTT pLKO.1 1410 CDS 100% 4.950 2.475 Y Vmn1r42 n/a
8 TRCN0000075662 TCAAGAACTATGTTCCTGAAT pLKO.1 1673 CDS 100% 4.950 2.475 Y Vmn1r42 n/a
9 TRCN0000120241 CCATTGGTCTCTTGTCCCTAA pLKO.1 1047 CDS 100% 4.050 2.025 Y Vmn1r48 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_011683.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.