Transcript: Mouse NM_011708.4

Mus musculus Von Willebrand factor (Vwf), mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Vwf (22371)
Length:
8834
CDS:
253..8694

Additional Resources:

NCBI RefSeq record:
NM_011708.4
NBCI Gene record:
Vwf (22371)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_011708.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000080068 GCGCTATGTAACTTCACAAAT pLKO.1 5586 CDS 100% 13.200 18.480 N Vwf n/a
2 TRCN0000080070 CCCACCATTTGATGAACACAA pLKO.1 8331 CDS 100% 4.950 6.930 N Vwf n/a
3 TRCN0000080071 GCCAGAGTCTTCCTTTGATAA pLKO.1 5358 CDS 100% 13.200 9.240 N Vwf n/a
4 TRCN0000080072 GCAGTGGTAGAGTACCATGAT pLKO.1 4201 CDS 100% 4.950 3.465 N Vwf n/a
5 TRCN0000080069 GCTAGGAATTTGGTCCGCTAT pLKO.1 4432 CDS 100% 4.050 2.835 N Vwf n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_011708.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.