Transcript: Mouse NM_011746.2

Mus musculus makorin, ring finger protein, 3 (Mkrn3), mRNA.

Source:
NCBI, updated 2017-04-16
Taxon:
Mus musculus (mouse)
Gene:
Mkrn3 (22652)
Length:
2565
CDS:
99..1733

Additional Resources:

NCBI RefSeq record:
NM_011746.2
NBCI Gene record:
Mkrn3 (22652)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_011746.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000040956 CGGCAATTGAGAGAGAGCATA pLKO.1 835 CDS 100% 4.950 6.930 N Mkrn3 n/a
2 TRCN0000437051 CCAGAAAGCGTGCAGGTATTT pLKO_005 1394 CDS 100% 13.200 10.560 N Mkrn3 n/a
3 TRCN0000428743 TGTTAACTTGTGGTTACTTTG pLKO_005 2208 3UTR 100% 10.800 8.640 N Mkrn3 n/a
4 TRCN0000418150 GAGGGAAACGTGCTGTTTAAA pLKO_005 1566 CDS 100% 15.000 10.500 N Mkrn3 n/a
5 TRCN0000417179 TCACTTCTAGTCTAGTGTTTA pLKO_005 2011 3UTR 100% 13.200 9.240 N Mkrn3 n/a
6 TRCN0000040955 GCTGGAAGAATATTTCAGTTT pLKO.1 1703 CDS 100% 4.950 3.465 N Mkrn3 n/a
7 TRCN0000040957 GTTTGAGAACAGGATCAGTAA pLKO.1 1262 CDS 100% 4.950 3.465 N Mkrn3 n/a
8 TRCN0000040954 CCATGGAGAAATATGCGACAT pLKO.1 989 CDS 100% 4.050 2.835 N Mkrn3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_011746.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.