Transcript: Mouse NM_011747.2

Mus musculus zinc finger protein 13 (Zfp13), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Zfp13 (22654)
Length:
2139
CDS:
417..1934

Additional Resources:

NCBI RefSeq record:
NM_011747.2
NBCI Gene record:
Zfp13 (22654)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_011747.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000082229 CGCTCCAATCTCATCGCACAT pLKO.1 1647 CDS 100% 4.050 5.670 N Zfp13 n/a
2 TRCN0000426767 CTTATACCTGCACGGACTGTG pLKO_005 1273 CDS 100% 4.050 5.670 N Zfp13 n/a
3 TRCN0000082230 TCCAATCTCATCGCACATAAT pLKO.1 1650 CDS 100% 13.200 9.240 N Zfp13 n/a
4 TRCN0000412820 ACGGACCAGAGAGCGAAAGAT pLKO_005 707 CDS 100% 5.625 3.938 N Zfp13 n/a
5 TRCN0000082232 TCAGGAGTCAACACACATCAA pLKO.1 545 CDS 100% 4.950 3.465 N Zfp13 n/a
6 TRCN0000413102 GCTAGTGGCCCAGGTACAAAG pLKO_005 1002 CDS 100% 3.600 2.520 N Zfp13 n/a
7 TRCN0000082231 CCAGGTAATGTGCAACACTGT pLKO.1 477 CDS 100% 2.640 1.848 N Zfp13 n/a
8 TRCN0000082228 CCTGAGAGAGAGCAGTGAGAA pLKO.1 1938 3UTR 100% 4.950 2.970 N Zfp13 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_011747.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.