Transcript: Mouse NM_011800.4

Mus musculus cadherin 20 (Cdh20), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Cdh20 (23836)
Length:
3722
CDS:
221..2626

Additional Resources:

NCBI RefSeq record:
NM_011800.4
NBCI Gene record:
Cdh20 (23836)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_011800.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000094678 CCAAGATAATACTGCTCGGAT pLKO.1 1864 CDS 100% 2.640 3.696 N Cdh20 n/a
2 TRCN0000094677 CCCTACATCATCGACGACGAT pLKO.1 2165 CDS 100% 2.640 2.112 N Cdh20 n/a
3 TRCN0000423326 CATCGCCACTGTGCCAGAAAT pLKO_005 730 CDS 100% 13.200 9.240 N Cdh20 n/a
4 TRCN0000416072 GAACAACCATACAGATCATTT pLKO_005 1434 CDS 100% 13.200 9.240 N CDH20 n/a
5 TRCN0000418027 GAACAACCATACAGATCATTT pLKO_005 1434 CDS 100% 13.200 9.240 N Cdh20 n/a
6 TRCN0000420005 GCTAGAATCTGCTCCAATTAG pLKO_005 1069 CDS 100% 13.200 9.240 N Cdh20 n/a
7 TRCN0000417371 AGGAGCAGGCATCGTGTTTAC pLKO_005 523 CDS 100% 10.800 7.560 N Cdh20 n/a
8 TRCN0000094675 CCCGATTTCCACAGAAACATT pLKO.1 1035 CDS 100% 5.625 3.938 N Cdh20 n/a
9 TRCN0000094676 GCAGAGATGAAGTATACCATT pLKO.1 1139 CDS 100% 4.950 3.465 N Cdh20 n/a
10 TRCN0000094674 GCCAAATAAGAAGTATCTGAT pLKO.1 3470 3UTR 100% 4.950 3.465 N Cdh20 n/a
11 TRCN0000166364 CACACACACACACACACACAA pLKO.1 3077 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_011800.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.