Transcript: Mouse NM_011846.5

Mus musculus matrix metallopeptidase 17 (Mmp17), mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Mmp17 (23948)
Length:
4477
CDS:
125..1861

Additional Resources:

NCBI RefSeq record:
NM_011846.5
NBCI Gene record:
Mmp17 (23948)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_011846.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000032872 CTGGGTGTTTAAGGACAACAA pLKO.1 1351 CDS 100% 4.950 6.930 N Mmp17 n/a
2 TRCN0000032873 CCCTTGAACTTCCACGAGGTA pLKO.1 635 CDS 100% 2.640 3.696 N Mmp17 n/a
3 TRCN0000049973 GCCCACAATGACAGGACTTAT pLKO.1 1448 CDS 100% 13.200 9.240 N MMP17 n/a
4 TRCN0000032869 CGTACCAGTGACCACAAGATT pLKO.1 1307 CDS 100% 5.625 3.938 N Mmp17 n/a
5 TRCN0000032870 CTCATGTACTACGCCCTCAAA pLKO.1 596 CDS 100% 4.950 3.465 N Mmp17 n/a
6 TRCN0000049975 ACTCATGTACTACGCCCTCAA pLKO.1 595 CDS 100% 4.050 2.835 N MMP17 n/a
7 TRCN0000032871 GCCGTCCATGAGTTTGGTCAT pLKO.1 857 CDS 100% 4.050 2.835 N Mmp17 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_011846.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.