Transcript: Mouse NM_011936.2

Mus musculus fat mass and obesity associated (Fto), mRNA.

Source:
NCBI, updated 2019-09-21
Taxon:
Mus musculus (mouse)
Gene:
Fto (26383)
Length:
3586
CDS:
52..1560

Additional Resources:

NCBI RefSeq record:
NM_011936.2
NBCI Gene record:
Fto (26383)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_011936.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000180978 CGATACAAACTTTGCACCGAT pLKO.1 1204 CDS 100% 2.640 3.696 N Fto n/a
2 TRCN0000277195 TAGTCTGACTTGGTGTTAAAT pLKO_005 1738 3UTR 100% 15.000 12.000 N Fto n/a
3 TRCN0000216341 GACGACACATACAGATGTTTA pLKO.1 2104 3UTR 100% 13.200 10.560 N Fto n/a
4 TRCN0000277143 TTGAAAGAGGAGCCCTATTTC pLKO_005 685 CDS 100% 13.200 9.240 N Fto n/a
5 TRCN0000184244 GACATCGAGACACCAGGATTA pLKO.1 877 CDS 100% 10.800 7.560 N Fto n/a
6 TRCN0000217933 GATGATGAAGTGGACCTTAAG pLKO.1 604 CDS 100% 10.800 7.560 N Fto n/a
7 TRCN0000178985 CAACGTGACTTTGCTAAACTT pLKO.1 639 CDS 100% 5.625 3.938 N Fto n/a
8 TRCN0000183897 CCAGGGAGACTGCTATTTCAT pLKO.1 912 CDS 100% 5.625 3.938 N Fto n/a
9 TRCN0000345577 CCAGGGAGACTGCTATTTCAT pLKO_005 912 CDS 100% 5.625 3.938 N Fto n/a
10 TRCN0000179651 GTCTCGTTGAAATCCTTTGAT pLKO.1 1102 CDS 100% 5.625 3.938 N Fto n/a
11 TRCN0000277193 GTCTCGTTGAAATCCTTTGAT pLKO_005 1102 CDS 100% 5.625 3.938 N Fto n/a
12 TRCN0000184243 GCCCACAGATTCTGAAGTGTT pLKO.1 1700 3UTR 100% 4.950 3.465 N Fto n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_011936.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.