Transcript: Mouse NM_011987.4

Mus musculus phospholipase A2, group X (Pla2g10), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Pla2g10 (26565)
Length:
926
CDS:
74..529

Additional Resources:

NCBI RefSeq record:
NM_011987.4
NBCI Gene record:
Pla2g10 (26565)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_011987.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000076945 GCTTACATGAACTATGGCTGT pLKO.1 212 CDS 100% 2.160 3.024 N Pla2g10 n/a
2 TRCN0000413921 GATTGTGTTGGGCCTCGATCT pLKO_005 185 CDS 100% 4.050 3.240 N Pla2g10 n/a
3 TRCN0000076946 CGCCATTGACTGGTGCTGCTA pLKO.1 268 CDS 100% 0.880 0.704 N Pla2g10 n/a
4 TRCN0000076944 CCACCTGAAATACCTCTTCTT pLKO.1 466 CDS 100% 4.950 3.465 N Pla2g10 n/a
5 TRCN0000050888 GCAGAGAACAAATGCCAAGAA pLKO.1 392 CDS 100% 4.950 3.465 N PLA2G10 n/a
6 TRCN0000222640 GCCAGTCTGATGAAGGTTCAA pLKO.1 692 3UTR 100% 4.950 3.465 N Pla2g10 n/a
7 TRCN0000443457 GTGCAATTGACAGGCTCACAT pLKO_005 520 CDS 100% 4.950 3.465 N Pla2g10 n/a
8 TRCN0000076947 CTAAGTTAGACCGCTACCCAT pLKO.1 336 CDS 100% 2.640 1.848 N Pla2g10 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_011987.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.