Transcript: Human NM_012109.3

Homo sapiens transmembrane protein 59 like (TMEM59L), mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
TMEM59L (25789)
Length:
1621
CDS:
90..1118

Additional Resources:

NCBI RefSeq record:
NM_012109.3
NBCI Gene record:
TMEM59L (25789)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_012109.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000435759 CTTCATGATGGAGCCCGATTG pLKO_005 1016 CDS 100% 6.000 8.400 N TMEM59L n/a
2 TRCN0000418007 GCCACCCAAACTGAGTGTGAA pLKO_005 381 CDS 100% 4.950 6.930 N TMEM59L n/a
3 TRCN0000422419 TCTTCTCCATCTGCCGATTTG pLKO_005 337 CDS 100% 10.800 7.560 N TMEM59L n/a
4 TRCN0000196133 GCAGACTGACAATGGGAAAGT pLKO.1 617 CDS 100% 4.950 3.465 N TMEM59L n/a
5 TRCN0000414194 GCAATGACCTTGTCAACTCAG pLKO_005 559 CDS 100% 4.050 2.835 N TMEM59L n/a
6 TRCN0000154679 GTGTTTCAGACTCAGCCCATA pLKO.1 642 CDS 100% 4.050 2.835 N TMEM59L n/a
7 TRCN0000153896 CAATGACTTCCTCAGTTGCAT pLKO.1 845 CDS 100% 3.000 2.100 N TMEM59L n/a
8 TRCN0000195861 CTTGCAGACTGACAATGGGAA pLKO.1 614 CDS 100% 2.640 1.848 N TMEM59L n/a
9 TRCN0000155368 CCTGGACATACTACTTGCAGA pLKO.1 601 CDS 100% 2.640 1.584 N TMEM59L n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_012109.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.