Transcript: Human NM_012115.4

Homo sapiens caspase 8 associated protein 2 (CASP8AP2), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-12
Taxon:
Homo sapiens (human)
Gene:
CASP8AP2 (9994)
Length:
6831
CDS:
256..6204

Additional Resources:

NCBI RefSeq record:
NM_012115.4
NBCI Gene record:
CASP8AP2 (9994)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_012115.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000229317 GGCATAGTTGATCGTTTATTT pLKO_005 3595 CDS 100% 15.000 21.000 N CASP8AP2 n/a
2 TRCN0000061764 CCAGTGTATAATAACAGTCAT pLKO.1 2893 CDS 100% 4.950 6.930 N CASP8AP2 n/a
3 TRCN0000218500 GATGTTCTGGAGGCAATTTAA pLKO_005 5390 CDS 100% 15.000 10.500 N CASP8AP2 n/a
4 TRCN0000218719 AGAGTCTTCAATGCAAGTTAA pLKO_005 2037 CDS 100% 13.200 9.240 N CASP8AP2 n/a
5 TRCN0000061763 GCCAGGATCAAATTGTGATAA pLKO.1 5700 CDS 100% 13.200 9.240 N CASP8AP2 n/a
6 TRCN0000218984 GGAAACCAAGTCAACGTTATT pLKO_005 2130 CDS 100% 13.200 9.240 N CASP8AP2 n/a
7 TRCN0000229318 TGGGACTCTTAACTGATATTG pLKO_005 6218 3UTR 100% 13.200 9.240 N CASP8AP2 n/a
8 TRCN0000061766 GCCAATTTACAAATCTGACAA pLKO.1 2988 CDS 100% 4.950 3.465 N CASP8AP2 n/a
9 TRCN0000061765 GCGAGTCTATACCAGCTTGTA pLKO.1 4307 CDS 100% 4.950 3.465 N CASP8AP2 n/a
10 TRCN0000061767 CCAGTCTCTTAAGAAGAATAT pLKO.1 579 CDS 100% 13.200 7.920 N CASP8AP2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_012115.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.