Transcript: Human NM_012308.3

Homo sapiens lysine demethylase 2A (KDM2A), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-05-28
Taxon:
Homo sapiens (human)
Gene:
KDM2A (22992)
Length:
7386
CDS:
871..4359

Additional Resources:

NCBI RefSeq record:
NM_012308.3
NBCI Gene record:
KDM2A (22992)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_012308.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000359651 TTCTGATGGACTCGGAATAAA pLKO_005 1110 CDS 100% 15.000 21.000 N KDM2A n/a
2 TRCN0000359598 GCTTACTCCACCGGCTGATAA pLKO_005 3936 CDS 100% 13.200 18.480 N KDM2A n/a
3 TRCN0000022000 GCTTGAGAGATCCTCTGATTT pLKO.1 1082 CDS 100% 13.200 18.480 N KDM2A n/a
4 TRCN0000363239 TTCGCTATCCATTCTACTATG pLKO_005 1841 CDS 100% 10.800 15.120 N KDM2A n/a
5 TRCN0000363274 ACTGACATGGCTCGTCAATAG pLKO_005 3774 CDS 100% 10.800 8.640 N KDM2A n/a
6 TRCN0000359581 GAGCGAGAGAAACTCTATAAT pLKO_005 1276 CDS 100% 15.000 10.500 N KDM2A n/a
7 TRCN0000359579 ATGCCACGCTTCGCCTCATAA pLKO_005 4028 CDS 100% 13.200 9.240 N KDM2A n/a
8 TRCN0000022002 CCCACAGGGATAGAAGATGAA pLKO.1 2305 CDS 100% 4.950 3.465 N KDM2A n/a
9 TRCN0000021999 GCCGCAGAGAACTTTGTGAAT pLKO.1 3587 CDS 100% 4.950 3.465 N KDM2A n/a
10 TRCN0000022001 GCATAGCTTCAACATCCCTAT pLKO.1 1770 CDS 100% 4.050 2.835 N KDM2A n/a
11 TRCN0000022003 GCTGATACAGAAGATCAGCTA pLKO.1 4338 CDS 100% 0.264 0.185 N KDM2A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_012308.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.