Transcript: Human NM_012340.5

Homo sapiens nuclear factor of activated T cells 2 (NFATC2), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
NFATC2 (4773)
Length:
7519
CDS:
221..2986

Additional Resources:

NCBI RefSeq record:
NM_012340.5
NBCI Gene record:
NFATC2 (4773)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_012340.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000230219 ACGGAGCCCACGGATGAATAT pLKO_005 2267 CDS 100% 13.200 18.480 N NFATC2 n/a
2 TRCN0000016143 CCGAGTCCAAAGTTGTGTTTA pLKO.1 2034 CDS 100% 13.200 18.480 N NFATC2 n/a
3 TRCN0000230216 TCCTCTTCGACTATGAGTATT pLKO_005 315 CDS 100% 13.200 18.480 N NFATC2 n/a
4 TRCN0000016145 GCACATCATGTACTGCGAGAA pLKO.1 2707 CDS 100% 4.050 5.670 N NFATC2 n/a
5 TRCN0000016144 CGCCAATAATGTCACCTCGAA pLKO.1 870 CDS 100% 2.640 3.696 N NFATC2 n/a
6 TRCN0000217956 GTGATCTTTGATCCGAGAAAT pLKO_005 2999 3UTR 100% 13.200 10.560 N NFATC2 n/a
7 TRCN0000230217 AGCTGATGAGCGGATCCTTAA pLKO_005 1606 CDS 100% 10.800 8.640 N NFATC2 n/a
8 TRCN0000016147 GTGAACTTCTACGTCATCAAT pLKO.1 2186 CDS 100% 5.625 4.500 N NFATC2 n/a
9 TRCN0000016146 CCTCTTCGACTATGAGTATTT pLKO.1 316 CDS 100% 13.200 9.240 N NFATC2 n/a
10 TRCN0000230218 AGCTTAGAAACGCCGACATTG pLKO_005 1779 CDS 100% 10.800 7.560 N NFATC2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_012340.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.