Transcript: Human NM_012454.3

Homo sapiens TIAM Rac1 associated GEF 2 (TIAM2), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-21
Taxon:
Homo sapiens (human)
Gene:
TIAM2 (26230)
Length:
5916
CDS:
209..5314

Additional Resources:

NCBI RefSeq record:
NM_012454.3
NBCI Gene record:
TIAM2 (26230)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_012454.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000450224 GTTAAGGTGATTCGTTCTATT pLKO_005 4547 CDS 100% 13.200 18.480 N TIAM2 n/a
2 TRCN0000107210 GCCCTACTAAAGACATCGAAA pLKO.1 4956 CDS 100% 4.950 6.930 N TIAM2 n/a
3 TRCN0000107214 CCTTTATTACGCGGACCACTT pLKO.1 3781 CDS 100% 4.050 5.670 N TIAM2 n/a
4 TRCN0000107211 CCACTTCAGAATGAGACCTTT pLKO.1 3590 CDS 100% 4.950 3.465 N TIAM2 n/a
5 TRCN0000107213 CCCTTGACAGTCAGTCTGAAA pLKO.1 5181 CDS 100% 4.950 3.465 N TIAM2 n/a
6 TRCN0000107212 CCTTTCTCACTTTAAGAGTAA pLKO.1 400 CDS 100% 4.950 3.465 N TIAM2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_012454.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.