Transcript: Human NM_012470.3

Homo sapiens transportin 3 (TNPO3), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-10
Taxon:
Homo sapiens (human)
Gene:
TNPO3 (23534)
Length:
4422
CDS:
404..3175

Additional Resources:

NCBI RefSeq record:
NM_012470.3
NBCI Gene record:
TNPO3 (23534)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_012470.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000038331 CGGCGCACAGAAATTATAGAA pLKO.1 896 CDS 100% 5.625 7.875 N TNPO3 n/a
2 TRCN0000291605 CGGCGCACAGAAATTATAGAA pLKO_005 896 CDS 100% 5.625 7.875 N TNPO3 n/a
3 TRCN0000038330 CCTCAATATGAGGTAGTAGAA pLKO.1 1403 CDS 100% 4.950 6.930 N TNPO3 n/a
4 TRCN0000291604 CCTCAATATGAGGTAGTAGAA pLKO_005 1403 CDS 100% 4.950 6.930 N TNPO3 n/a
5 TRCN0000038329 CCTATCTTACAGTGGGCCATT pLKO.1 2726 CDS 100% 4.050 5.670 N TNPO3 n/a
6 TRCN0000038332 CGAGCTGATAATCGGATTGTA pLKO.1 2360 CDS 100% 5.625 4.500 N TNPO3 n/a
7 TRCN0000296949 ACCAGACTGTGTCCCACAATC pLKO_005 3246 3UTR 100% 10.800 7.560 N TNPO3 n/a
8 TRCN0000038333 CCGATTACCTTTGGATAAGAT pLKO.1 2113 CDS 100% 5.625 3.938 N TNPO3 n/a
9 TRCN0000307728 CCGATTACCTTTGGATAAGAT pLKO_005 2113 CDS 100% 5.625 3.938 N TNPO3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_012470.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.