Transcript: Mouse NM_013492.3

Mus musculus clusterin (Clu), mRNA.

Source:
NCBI, updated 2017-06-11
Taxon:
Mus musculus (mouse)
Gene:
Clu (12759)
Length:
1832
CDS:
234..1580

Additional Resources:

NCBI RefSeq record:
NM_013492.3
NBCI Gene record:
Clu (12759)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_013492.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000079924 CCAGGGAGTGAAGCACATAAA pLKO.1 380 CDS 100% 13.200 9.240 N Clu n/a
2 TRCN0000079927 CATACCTGCATGAAGTTCTAT pLKO.1 585 CDS 100% 5.625 3.938 N Clu n/a
3 TRCN0000079926 GCATACCTGCATGAAGTTCTA pLKO.1 584 CDS 100% 4.950 3.465 N Clu n/a
4 TRCN0000079925 GCCTCATTTCTTATATCCCAA pLKO.1 875 CDS 100% 2.640 1.848 N Clu n/a
5 TRCN0000079923 CCTTCCTATATGTAGGAGTGT pLKO.1 1594 3UTR 100% 0.264 0.185 N Clu n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_013492.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.