Transcript: Mouse NM_013507.3

Mus musculus eukaryotic translation initiation factor 4, gamma 2 (Eif4g2), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-07-02
Taxon:
Mus musculus (mouse)
Gene:
Eif4g2 (13690)
Length:
7760
CDS:
333..3053

Additional Resources:

NCBI RefSeq record:
NM_013507.3
NBCI Gene record:
Eif4g2 (13690)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_013507.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000276485 ATGGGACGTCATCGTTCAAAT pLKO_005 1521 CDS 100% 13.200 18.480 N EIF4G2 n/a
2 TRCN0000009807 GCAGCAAACAACTCCGCAAAT pLKO.1 519 CDS 100% 10.800 15.120 N Eif4g2 n/a
3 TRCN0000278104 GCAGCAAACAACTCCGCAAAT pLKO_005 519 CDS 100% 10.800 15.120 N Eif4g2 n/a
4 TRCN0000009810 CCCACTCCTTAAATTGGAGAA pLKO.1 2513 CDS 100% 4.050 3.240 N Eif4g2 n/a
5 TRCN0000278106 CCCACTCCTTAAATTGGAGAA pLKO_005 2513 CDS 100% 4.050 3.240 N Eif4g2 n/a
6 TRCN0000276423 ATGGACCAAAGACGATCAATC pLKO_005 1285 CDS 100% 10.800 7.560 N EIF4G2 n/a
7 TRCN0000009809 GCCTTAGAAGAGCCAAAGTAT pLKO.1 696 CDS 100% 5.625 3.938 N Eif4g2 n/a
8 TRCN0000278170 GCCTTAGAAGAGCCAAAGTAT pLKO_005 696 CDS 100% 5.625 3.938 N Eif4g2 n/a
9 TRCN0000009808 CCACCATCAAAGGAAGAACTA pLKO.1 1941 CDS 100% 4.950 3.465 N Eif4g2 n/a
10 TRCN0000278169 CCACCATCAAAGGAAGAACTA pLKO_005 1941 CDS 100% 4.950 3.465 N Eif4g2 n/a
11 TRCN0000009806 GCCAGTTACCATAGGCTGTTT pLKO.1 3351 3UTR 100% 4.950 3.465 N Eif4g2 n/a
12 TRCN0000278105 GCCAGTTACCATAGGCTGTTT pLKO_005 3351 3UTR 100% 4.950 3.465 N Eif4g2 n/a
13 TRCN0000146323 CCAAAGCCTTAAATTGTGCAA pLKO.1 3062 3UTR 100% 2.640 1.848 N EIF4G2 n/a
14 TRCN0000147914 GCAACACTGAATACTGTAGAA pLKO.1 3391 3UTR 100% 4.950 3.465 N EIF4G2 n/a
15 TRCN0000276424 GCAACACTGAATACTGTAGAA pLKO_005 3391 3UTR 100% 4.950 3.465 N EIF4G2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_013507.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.