Transcript: Mouse NM_013513.3

Mus musculus erythrocyte membrane protein band 4.2 (Epb42), mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Epb42 (13828)
Length:
3920
CDS:
285..2360

Additional Resources:

NCBI RefSeq record:
NM_013513.3
NBCI Gene record:
Epb42 (13828)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_013513.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000091451 GCCAATTCACACTGCTCTTTA pLKO.1 679 CDS 100% 13.200 18.480 N Epb42 n/a
2 TRCN0000091449 CCATTGGTAAACCGGATCTTA pLKO.1 2035 CDS 100% 5.625 7.875 N Epb42 n/a
3 TRCN0000091450 GCAACCTTCCAAGATCAATAA pLKO.1 485 CDS 100% 13.200 9.240 N Epb42 n/a
4 TRCN0000091452 GCCCAGGCTTTGTACTACAAT pLKO.1 1821 CDS 100% 5.625 3.375 N Epb42 n/a
5 TRCN0000091448 CCTCCCAAGTACTGGGATTAA pLKO.1 2617 3UTR 100% 1.320 0.660 Y Epb42 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_013513.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.