Transcript: Mouse NM_013557.2

Mus musculus eukaryotic translation initiation factor 2 alpha kinase 1 (Eif2ak1), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Eif2ak1 (15467)
Length:
2805
CDS:
100..1959

Additional Resources:

NCBI RefSeq record:
NM_013557.2
NBCI Gene record:
Eif2ak1 (15467)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_013557.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000235939 CTGATTAAGAGCGCAACTAAA pLKO_005 694 CDS 100% 13.200 18.480 N Eif2ak1 n/a
2 TRCN0000235938 GGACTTGCATTATAGTCAATA pLKO_005 2016 3UTR 100% 13.200 18.480 N Eif2ak1 n/a
3 TRCN0000235942 TCCGGTGCAAGCCAAGTATAT pLKO_005 1749 CDS 100% 13.200 18.480 N Eif2ak1 n/a
4 TRCN0000028798 CCTGATTAAGAGCGCAACTAA pLKO.1 693 CDS 100% 5.625 7.875 N Eif2ak1 n/a
5 TRCN0000235940 GGTCAGCATTATGCAATTAAG pLKO_005 667 CDS 100% 13.200 10.560 N Eif2ak1 n/a
6 TRCN0000028823 CCCTATGTTATGGCCAGTGTT pLKO.1 1327 CDS 100% 4.950 3.960 N Eif2ak1 n/a
7 TRCN0000235941 ACAAACGTCACGCTACTTAAA pLKO_005 573 CDS 100% 13.200 9.240 N Eif2ak1 n/a
8 TRCN0000028813 CCCAAGTATGATGAGTCCGAT pLKO.1 205 CDS 100% 2.640 1.848 N Eif2ak1 n/a
9 TRCN0000028825 GCCAAGTATATCCAGCTCCTA pLKO.1 1759 CDS 100% 2.640 1.848 N Eif2ak1 n/a
10 TRCN0000028788 GCTCGGAATTGGAAGGGAATT pLKO.1 1136 CDS 100% 0.000 0.000 N Eif2ak1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_013557.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.