Transcript: Mouse NM_013612.2

Mus musculus solute carrier family 11 (proton-coupled divalent metal ion transporters), member 1 (Slc11a1), mRNA.

Source:
NCBI, updated 2017-06-25
Taxon:
Mus musculus (mouse)
Gene:
Slc11a1 (18173)
Length:
2304
CDS:
113..1759

Additional Resources:

NCBI RefSeq record:
NM_013612.2
NBCI Gene record:
Slc11a1 (18173)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_013612.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000079523 CCTCGGAATAATGACACCATT pLKO.1 1868 3UTR 100% 4.950 6.930 N Slc11a1 n/a
2 TRCN0000079524 CCTCCAGAACTATGCTAAGAT pLKO.1 1081 CDS 100% 5.625 3.938 N Slc11a1 n/a
3 TRCN0000079526 CCAGAACTATGCTAAGATCTT pLKO.1 1084 CDS 100% 4.950 3.465 N Slc11a1 n/a
4 TRCN0000079525 GCCTTGGTCAAGTCTAGAGAA pLKO.1 887 CDS 100% 4.950 3.465 N Slc11a1 n/a
5 TRCN0000079527 CTTCTTATATGGGCTCCCTAA pLKO.1 1705 CDS 100% 4.050 2.835 N Slc11a1 n/a
6 TRCN0000182716 CCTGAGTTCAATTCCCAGCAA pLKO.1 2188 3UTR 100% 2.640 1.320 Y BC028528 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_013612.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.