Transcript: Mouse NM_013667.2

Mus musculus solute carrier family 22 (organic cation transporter), member 2 (Slc22a2), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Slc22a2 (20518)
Length:
2138
CDS:
93..1754

Additional Resources:

NCBI RefSeq record:
NM_013667.2
NBCI Gene record:
Slc22a2 (20518)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_013667.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000070177 CGGGCTGGTTAATTGGCTATA pLKO.1 739 CDS 100% 10.800 15.120 N Slc22a2 n/a
2 TRCN0000070173 CCCACATACATCAGGAATCTT pLKO.1 1467 CDS 100% 5.625 3.938 N Slc22a2 n/a
3 TRCN0000070174 GCAGAACAGTAGGGATTTGTT pLKO.1 793 CDS 100% 5.625 3.938 N Slc22a2 n/a
4 TRCN0000070175 GCATCACCATAGCCTACGAAA pLKO.1 1417 CDS 100% 4.950 3.465 N Slc22a2 n/a
5 TRCN0000070176 GCTGGACCTGTTTCAGTCATT pLKO.1 536 CDS 100% 4.950 3.465 N Slc22a2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_013667.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.