Transcript: Mouse NM_013688.2

Mus musculus t-complex-associated testis expressed 1 (Tcte1), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Tcte1 (21645)
Length:
3074
CDS:
238..1734

Additional Resources:

NCBI RefSeq record:
NM_013688.2
NBCI Gene record:
Tcte1 (21645)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_013688.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000250974 TTGATTGACGATGAGAATTAC pLKO_005 601 CDS 100% 13.200 18.480 N Tcte1 n/a
2 TRCN0000250970 AGTAAGGTGGACGACGATAAG pLKO_005 1096 CDS 100% 10.800 15.120 N Tcte1 n/a
3 TRCN0000250973 CCGGCAACCACACCTTCATTT pLKO_005 1774 3UTR 100% 13.200 9.240 N Tcte1 n/a
4 TRCN0000250971 ACCTATCCTGCAACCACATTG pLKO_005 1502 CDS 100% 10.800 7.560 N Tcte1 n/a
5 TRCN0000250972 AGGAGAGCGAGTACCTCATTG pLKO_005 1610 CDS 100% 10.800 7.560 N Tcte1 n/a
6 TRCN0000184769 CTTCTCCTCACCCACTAACAA pLKO.1 1689 CDS 100% 5.625 3.938 N Tcte1 n/a
7 TRCN0000195785 CCTCACCCACTAACAACTGTA pLKO.1 1694 CDS 100% 4.950 3.465 N Tcte1 n/a
8 TRCN0000183625 GCTGACTAATTCAAACTCTTA pLKO.1 2620 3UTR 100% 4.950 3.465 N Tcte1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_013688.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.