Transcript: Mouse NM_013724.2

Mus musculus Nik related kinase (Nrk), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Nrk (27206)
Length:
6604
CDS:
323..4690

Additional Resources:

NCBI RefSeq record:
NM_013724.2
NBCI Gene record:
Nrk (27206)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_013724.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000025299 CGCTTATATCTGTCGAGAAAT pLKO.1 784 CDS 100% 13.200 18.480 N Nrk n/a
2 TRCN0000361690 TCACCGCCTTATTCTACTATT pLKO_005 2870 CDS 100% 13.200 18.480 N Nrk n/a
3 TRCN0000025302 GCACCAACTTTGGATGGTAAT pLKO.1 688 CDS 100% 10.800 15.120 N Nrk n/a
4 TRCN0000025300 GCCAAATAATAATGTCGTCAT pLKO.1 4309 CDS 100% 4.050 5.670 N Nrk n/a
5 TRCN0000025301 CCGCCTTATTCTACTATTGAT pLKO.1 2873 CDS 100% 5.625 4.500 N Nrk n/a
6 TRCN0000361613 CCAAGTGAAGGTTAGATTAAA pLKO_005 5082 3UTR 100% 15.000 10.500 N Nrk n/a
7 TRCN0000361614 GCCATTGGTCTTGGTACTTAT pLKO_005 410 CDS 100% 13.200 9.240 N Nrk n/a
8 TRCN0000025303 CCAGAGTTTGAACATGAGGAA pLKO.1 3518 CDS 100% 2.640 1.848 N Nrk n/a
9 TRCN0000194800 CCACAAAGTATACCTCAATAT pLKO.1 5960 3UTR 100% 13.200 9.240 N NRK n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_013724.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.