Transcript: Mouse NM_013737.5

Mus musculus phospholipase A2, group VII (platelet-activating factor acetylhydrolase, plasma) (Pla2g7), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Pla2g7 (27226)
Length:
1923
CDS:
371..1693

Additional Resources:

NCBI RefSeq record:
NM_013737.5
NBCI Gene record:
Pla2g7 (27226)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_013737.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000076875 CGTTTGTACTACCCAGCTCAA pLKO.1 611 CDS 100% 4.050 5.670 N Pla2g7 n/a
2 TRCN0000317600 CGTTTGTACTACCCAGCTCAA pLKO_005 611 CDS 100% 4.050 5.670 N Pla2g7 n/a
3 TRCN0000076874 GCCGTCAGTAATGTTTCACAA pLKO.1 469 CDS 100% 4.950 3.960 N Pla2g7 n/a
4 TRCN0000076877 CGGAAAGAACAGGTTCAGCAA pLKO.1 1019 CDS 100% 2.640 2.112 N Pla2g7 n/a
5 TRCN0000317602 CGGAAAGAACAGGTTCAGCAA pLKO_005 1019 CDS 100% 2.640 2.112 N Pla2g7 n/a
6 TRCN0000350009 GGAGCCTTCAGGACGATTTAT pLKO_005 827 CDS 100% 15.000 10.500 N Pla2g7 n/a
7 TRCN0000076876 CTTGGCATCTAATGGGTTTAT pLKO.1 865 CDS 100% 13.200 9.240 N Pla2g7 n/a
8 TRCN0000317601 CTTGGCATCTAATGGGTTTAT pLKO_005 865 CDS 100% 13.200 9.240 N Pla2g7 n/a
9 TRCN0000076873 GCTTGTTACACAGTTGCCTTT pLKO.1 1702 3UTR 100% 4.050 2.835 N Pla2g7 n/a
10 TRCN0000317603 GCTTGTTACACAGTTGCCTTT pLKO_005 1702 3UTR 100% 4.050 2.835 N Pla2g7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_013737.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.