Transcript: Mouse NM_013738.3

Mus musculus pleckstrin 2 (Plek2), mRNA.

Source:
NCBI, updated 2017-06-25
Taxon:
Mus musculus (mouse)
Gene:
Plek2 (27260)
Length:
1570
CDS:
7..1068

Additional Resources:

NCBI RefSeq record:
NM_013738.3
NBCI Gene record:
Plek2 (27260)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_013738.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000306395 AGGATGACACACACTATTATA pLKO_005 986 CDS 100% 15.000 10.500 N Plek2 n/a
2 TRCN0000091413 CCTTCCTATGACCAACTTTAA pLKO.1 1328 3UTR 100% 13.200 9.240 N Plek2 n/a
3 TRCN0000332424 CCTTCCTATGACCAACTTTAA pLKO_005 1328 3UTR 100% 13.200 9.240 N Plek2 n/a
4 TRCN0000311534 ACTGGAAGGTGCGCAGATTTG pLKO_005 794 CDS 100% 10.800 7.560 N Plek2 n/a
5 TRCN0000091414 CCAGCTTTCCTGCACTACTAT pLKO.1 829 CDS 100% 5.625 3.938 N Plek2 n/a
6 TRCN0000332349 CCAGCTTTCCTGCACTACTAT pLKO_005 829 CDS 100% 5.625 3.938 N Plek2 n/a
7 TRCN0000091415 GCATCGAATTGTGGACAAGAT pLKO.1 393 CDS 100% 4.950 3.465 N Plek2 n/a
8 TRCN0000091416 GCCGCTCCTCATTAAACTGAA pLKO.1 210 CDS 100% 4.950 3.465 N Plek2 n/a
9 TRCN0000091417 CATACTGAAGAACTCCTTCAA pLKO.1 351 CDS 100% 0.495 0.347 N Plek2 n/a
10 TRCN0000332350 CATACTGAAGAACTCCTTCAA pLKO_005 351 CDS 100% 0.495 0.347 N Plek2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_013738.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.