Transcript: Mouse NM_013739.2

Mus musculus docking protein 3 (Dok3), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Dok3 (27261)
Length:
1546
CDS:
25..1359

Additional Resources:

NCBI RefSeq record:
NM_013739.2
NBCI Gene record:
Dok3 (27261)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_013739.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000421209 AGTGACCGAGTTTCCGGTGAT pLKO_005 495 CDS 100% 4.050 5.670 N Dok3 n/a
2 TRCN0000097244 CCAGGAACAACTTCGAACATA pLKO.1 1406 3UTR 100% 5.625 3.938 N Dok3 n/a
3 TRCN0000097248 GCAGCCCTATCTACCATAACA pLKO.1 1145 CDS 100% 5.625 3.938 N Dok3 n/a
4 TRCN0000439143 ACATCCAACTGAGGGAGACAT pLKO_005 587 CDS 100% 4.950 3.465 N Dok3 n/a
5 TRCN0000431891 CTACCGTTTCCTGCGCAAGTA pLKO_005 636 CDS 100% 4.950 3.465 N Dok3 n/a
6 TRCN0000097247 GACAAGGGTGTGTTCTCGTTT pLKO.1 664 CDS 100% 4.950 3.465 N Dok3 n/a
7 TRCN0000445259 TACGCTTGGCTGACTGTGTAT pLKO_005 239 CDS 100% 4.950 3.465 N Dok3 n/a
8 TRCN0000438618 CTCTATGAGAACGTGTGCATG pLKO_005 1048 CDS 100% 4.050 2.835 N Dok3 n/a
9 TRCN0000097246 CCGGAGAATGTTCGTCAGGAT pLKO.1 401 CDS 100% 2.640 1.848 N Dok3 n/a
10 TRCN0000097245 GCAGCACGTAAAGTTTGGCAA pLKO.1 69 CDS 100% 2.640 1.848 N Dok3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_013739.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.