Transcript: Mouse NM_013779.2

Mus musculus melanoma antigen, family L, 2 (Magel2), mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Magel2 (27385)
Length:
4662
CDS:
372..4226

Additional Resources:

NCBI RefSeq record:
NM_013779.2
NBCI Gene record:
Magel2 (27385)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_013779.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000366505 GGCGTACCCTCAGTGTAATTT pLKO_005 3746 CDS 100% 15.000 21.000 N Magel2 n/a
2 TRCN0000366502 TTCCCTGTTTGGTGTACTAAT pLKO_005 4465 3UTR 100% 13.200 18.480 N Magel2 n/a
3 TRCN0000376951 GTGCCAGAGGTCCAATCATTC pLKO_005 1270 CDS 100% 10.800 15.120 N Magel2 n/a
4 TRCN0000366503 TAGAATACAAGGACGCAAATG pLKO_005 4135 CDS 100% 10.800 8.640 N Magel2 n/a
5 TRCN0000376873 TCACTAATAGACGTTACTAAG pLKO_005 4220 CDS 100% 10.800 8.640 N Magel2 n/a
6 TRCN0000366565 TCAGCCTTTGATCCTACAAAT pLKO_005 1370 CDS 100% 13.200 9.240 N Magel2 n/a
7 TRCN0000376952 ATAGGGAGAGTCAGCCCTTAT pLKO_005 3499 CDS 100% 10.800 7.560 N Magel2 n/a
8 TRCN0000366504 TTTGCTCTGCAGGATCCTTAT pLKO_005 2961 CDS 100% 10.800 7.560 N Magel2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_013779.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.