Transcript: Mouse NM_013796.3

Mus musculus N-acetylglucosamine-1-phosphodiester alpha-N-acetylglucosaminidase (Nagpa), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Nagpa (27426)
Length:
2152
CDS:
31..1584

Additional Resources:

NCBI RefSeq record:
NM_013796.3
NBCI Gene record:
Nagpa (27426)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_013796.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000119408 CGTCAACAAGATGTCGTCAAT pLKO.1 856 CDS 100% 4.950 6.930 N Nagpa n/a
2 TRCN0000119409 CCGCAATGGAAACATCTACAT pLKO.1 651 CDS 100% 4.950 3.960 N Nagpa n/a
3 TRCN0000119411 CCCTCACCCTGACACTAATTT pLKO.1 1388 CDS 100% 15.000 10.500 N Nagpa n/a
4 TRCN0000435145 CACCCTTTGCTGGCCATATTC pLKO_005 1681 3UTR 100% 13.200 9.240 N Nagpa n/a
5 TRCN0000119407 GCTCATGCCAACCTAGCAATA pLKO.1 1721 3UTR 100% 10.800 7.560 N Nagpa n/a
6 TRCN0000437181 ACGGCATGCTCCAGATAATCT pLKO_005 1597 3UTR 100% 5.625 3.938 N Nagpa n/a
7 TRCN0000119410 CTTATCCTCTTCCATGCTGAT pLKO.1 784 CDS 100% 4.050 2.835 N Nagpa n/a
8 TRCN0000166364 CACACACACACACACACACAA pLKO.1 1928 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_013796.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.