Transcript: Mouse NM_013799.3

Mus musculus arginyltransferase 1 (Ate1), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Ate1 (11907)
Length:
4768
CDS:
120..1670

Additional Resources:

NCBI RefSeq record:
NM_013799.3
NBCI Gene record:
Ate1 (11907)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_013799.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000366532 ATGAGAATCTTGTGGTTAATA pLKO_005 1799 3UTR 100% 15.000 21.000 N Ate1 n/a
2 TRCN0000366600 TGCCATGCCTTACGGTGTTTA pLKO_005 1547 CDS 100% 13.200 18.480 N Ate1 n/a
3 TRCN0000375423 TCTACTACGATCCTGATTATT pLKO_005 1216 CDS 100% 15.000 12.000 N Ate1 n/a
4 TRCN0000375424 GATGAGATACAAGGGTCAATA pLKO_005 1358 CDS 100% 13.200 10.560 N Ate1 n/a
5 TRCN0000366533 CATCGCAACTCAGCTATTATT pLKO_005 1306 CDS 100% 15.000 10.500 N Ate1 n/a
6 TRCN0000124628 GAGTCTTACCAGGTCTATAAA pLKO.1 981 CDS 100% 15.000 10.500 N Ate1 n/a
7 TRCN0000366599 AGGATTATCAGGATCTTATAG pLKO_005 253 CDS 100% 13.200 9.240 N Ate1 n/a
8 TRCN0000124625 GCCATGCCTTACGGTGTTTAT pLKO.1 1548 CDS 100% 13.200 9.240 N Ate1 n/a
9 TRCN0000366598 GGAGTCTTACCAGGTCTATAA pLKO_005 980 CDS 100% 13.200 9.240 N Ate1 n/a
10 TRCN0000375425 GGCTCGATGGGAAGATCATTG pLKO_005 1147 CDS 100% 10.800 7.560 N Ate1 n/a
11 TRCN0000124624 CGGCTGATTCTGTCAGTGATT pLKO.1 4018 3UTR 100% 4.950 3.465 N Ate1 n/a
12 TRCN0000124626 GCCAGTTTACAAGATTCCTTT pLKO.1 1051 CDS 100% 4.950 3.465 N Ate1 n/a
13 TRCN0000124627 GCATTAATTAACAAGCTGGAT pLKO.1 504 CDS 100% 2.640 1.848 N Ate1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_013799.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.