Transcript: Mouse NM_013800.2

Mus musculus BarH-like homeobox 2 (Barx2), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Barx2 (12023)
Length:
1791
CDS:
195..1046

Additional Resources:

NCBI RefSeq record:
NM_013800.2
NBCI Gene record:
Barx2 (12023)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_013800.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000428546 ACGCAGAAGTCGCACCATCTT pLKO_005 605 CDS 100% 4.950 6.930 N Barx2 n/a
2 TRCN0000436526 GACTTTCATGATCGATGAGAT pLKO_005 263 CDS 100% 4.950 6.930 N Barx2 n/a
3 TRCN0000013235 GCGCTACAAGACTTTCATGAT pLKO.1 254 CDS 100% 4.950 3.960 N BARX2 n/a
4 TRCN0000070510 CGCCCTAAGAAGAATTCCATT pLKO.1 822 CDS 100% 0.000 0.000 N Barx2 n/a
5 TRCN0000070512 TGGAAGAAGATGGTCCTTAAA pLKO.1 768 CDS 100% 13.200 9.240 N Barx2 n/a
6 TRCN0000412716 AGGGAGAGAAGACCTCTAAAG pLKO_005 1109 3UTR 100% 10.800 7.560 N Barx2 n/a
7 TRCN0000070509 CCCACATCAGAGGAGATTGAA pLKO.1 843 CDS 100% 5.625 3.938 N Barx2 n/a
8 TRCN0000070508 GCGACTACTTTGAGAAACTTT pLKO.1 301 CDS 100% 5.625 3.938 N Barx2 n/a
9 TRCN0000070511 GCTGCAAGTGAAGACTTGGTA pLKO.1 728 CDS 100% 0.300 0.210 N Barx2 n/a
10 TRCN0000013236 CGCAGGATGAAATGGAAGAAA pLKO.1 756 CDS 100% 5.625 3.375 N BARX2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_013800.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.