Transcript: Mouse NM_013806.2

Mus musculus ATP-binding cassette, sub-family C (CFTR/MRP), member 2 (Abcc2), mRNA.

Source:
NCBI, updated 2017-06-11
Taxon:
Mus musculus (mouse)
Gene:
Abcc2 (12780)
Length:
5389
CDS:
97..4728

Additional Resources:

NCBI RefSeq record:
NM_013806.2
NBCI Gene record:
Abcc2 (12780)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_013806.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000111078 GCACCATCTTAGAGAAGGGAT pLKO.1 2600 CDS 100% 2.640 2.112 N Abcc2 n/a
2 TRCN0000306212 ATCGGAGAGAAGGGTATAAAT pLKO_005 2350 CDS 100% 15.000 10.500 N Abcc2 n/a
3 TRCN0000111076 CGGCCTTGCTTCTGGTTATTT pLKO.1 3755 CDS 100% 15.000 10.500 N Abcc2 n/a
4 TRCN0000325987 CGGCCTTGCTTCTGGTTATTT pLKO_005 3755 CDS 100% 15.000 10.500 N Abcc2 n/a
5 TRCN0000111079 CCTTGGCAACTTTACAGAATA pLKO.1 226 CDS 100% 13.200 9.240 N Abcc2 n/a
6 TRCN0000325988 CCTTGGCAACTTTACAGAATA pLKO_005 226 CDS 100% 13.200 9.240 N Abcc2 n/a
7 TRCN0000306211 GAAAGCGTGAGGGTCCGATTT pLKO_005 4999 3UTR 100% 10.800 7.560 N Abcc2 n/a
8 TRCN0000111077 CCCATCAGCTACAGCTTCATT pLKO.1 672 CDS 100% 5.625 3.938 N Abcc2 n/a
9 TRCN0000326063 CCCATCAGCTACAGCTTCATT pLKO_005 672 CDS 100% 5.625 3.938 N Abcc2 n/a
10 TRCN0000111075 CGGGCATAGTTGTCCATGATA pLKO.1 5059 3UTR 100% 5.625 3.938 N Abcc2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_013806.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.