Transcript: Mouse NM_013809.1

Mus musculus cytochrome P450, family 2, subfamily g, polypeptide 1 (Cyp2g1), mRNA.

Source:
NCBI, updated 2017-03-30
Taxon:
Mus musculus (mouse)
Gene:
Cyp2g1 (13108)
Length:
1853
CDS:
1..1485

Additional Resources:

NCBI RefSeq record:
NM_013809.1
NBCI Gene record:
Cyp2g1 (13108)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_013809.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000439854 TGACCGTCCTTCGAAACTTTG pLKO_005 395 CDS 100% 10.800 15.120 N Cyp2g1 n/a
2 TRCN0000124578 GTTCCACGTTACGGTATGGAT pLKO.1 920 CDS 100% 3.000 4.200 N Cyp2g1 n/a
3 TRCN0000124576 GCTACCTTCTACCTAAGGGTA pLKO.1 1145 CDS 100% 2.640 3.696 N Cyp2g1 n/a
4 TRCN0000124575 CGTGGTGAAATGCCTACACTA pLKO.1 301 CDS 100% 4.950 3.960 N Cyp2g1 n/a
5 TRCN0000124574 GCCTGAGGGTTTCATTAAATT pLKO.1 1677 3UTR 100% 15.000 10.500 N Cyp2g1 n/a
6 TRCN0000444240 GCCTCATGAGGATGATCAATG pLKO_005 599 CDS 100% 10.800 7.560 N Cyp2g1 n/a
7 TRCN0000124577 CGAGGAGATTAACCAGGTGAT pLKO.1 984 CDS 100% 4.050 2.835 N Cyp2g1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_013809.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.