Transcript: Mouse NM_013815.2

Mus musculus bromodomain adjacent to zinc finger domain 1A (Baz1a), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Baz1a (217578)
Length:
6179
CDS:
205..4863

Additional Resources:

NCBI RefSeq record:
NM_013815.2
NBCI Gene record:
Baz1a (217578)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_013815.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000241701 ATGCAATCGATCCCTTATTAT pLKO_005 752 CDS 100% 15.000 21.000 N Baz1a n/a
2 TRCN0000241700 TATCGGAACAAAGCTATTAAA pLKO_005 1102 CDS 100% 15.000 21.000 N Baz1a n/a
3 TRCN0000244322 CGCGATCCTCAGGTATCTATT pLKO_005 2752 CDS 100% 13.200 18.480 N Baz1a n/a
4 TRCN0000241702 TTCCAAATACATGGTTGATTT pLKO_005 5818 3UTR 100% 13.200 10.560 N Baz1a n/a
5 TRCN0000244323 CTATGTCAAGGACCGATATTT pLKO_005 534 CDS 100% 15.000 10.500 N Baz1a n/a
6 TRCN0000176105 GTGAGCAATGTGGTTCATTAT pLKO.1 3415 CDS 100% 13.200 9.240 N Baz1a n/a
7 TRCN0000174304 CTCTGAAGAGAAATTCCATTT pLKO.1 3009 CDS 100% 10.800 7.560 N Baz1a n/a
8 TRCN0000174786 GATATTGAGGACAGAATCTAT pLKO.1 3154 CDS 100% 5.625 3.938 N Baz1a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_013815.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.