Transcript: Mouse NM_013838.2

Mus musculus transient receptor potential cation channel, subfamily C, member 6 (Trpc6), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-25
Taxon:
Mus musculus (mouse)
Gene:
Trpc6 (22068)
Length:
3259
CDS:
291..3083

Additional Resources:

NCBI RefSeq record:
NM_013838.2
NBCI Gene record:
Trpc6 (22068)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_013838.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000068397 CGTTCTGTATGGTGTCTATAA pLKO.1 2402 CDS 100% 13.200 18.480 N Trpc6 n/a
2 TRCN0000068394 GCTCATTATATCCTGGGTAAT pLKO.1 1775 CDS 100% 10.800 15.120 N Trpc6 n/a
3 TRCN0000068393 CCCTCAGAAGTGCATATTTAT pLKO.1 3092 3UTR 100% 15.000 10.500 N Trpc6 n/a
4 TRCN0000044103 CCTGGGTAATAGGCATGATAT pLKO.1 1786 CDS 100% 13.200 9.240 N TRPC6 n/a
5 TRCN0000068396 GCTGCACATTGCCAGGAATAT pLKO.1 963 CDS 100% 13.200 9.240 N Trpc6 n/a
6 TRCN0000068395 CGTCCAAATCTCAGCCGTTTA pLKO.1 1365 CDS 100% 10.800 7.560 N Trpc6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_013838.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.