Transcript: Mouse NM_013865.2

Mus musculus N-myc downstream regulated gene 3 (Ndrg3), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Ndrg3 (29812)
Length:
2644
CDS:
159..1286

Additional Resources:

NCBI RefSeq record:
NM_013865.2
NBCI Gene record:
Ndrg3 (29812)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_013865.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000197659 CGACCCTATAAATACAACTTT pLKO.1 989 CDS 100% 5.625 7.875 N Ndrg3 n/a
2 TRCN0000279053 CGACCCTATAAATACAACTTT pLKO_005 989 CDS 100% 5.625 7.875 N Ndrg3 n/a
3 TRCN0000182355 GCTCAACCATAAGTCCTGCTT pLKO.1 350 CDS 100% 2.640 3.696 N Ndrg3 n/a
4 TRCN0000278986 GCTCAACCATAAGTCCTGCTT pLKO_005 350 CDS 100% 2.640 3.696 N Ndrg3 n/a
5 TRCN0000176687 CCATGCCATTACTGTAACATT pLKO.1 1466 3UTR 100% 5.625 3.938 N Ndrg3 n/a
6 TRCN0000279055 CCATGCCATTACTGTAACATT pLKO_005 1466 3UTR 100% 5.625 3.938 N Ndrg3 n/a
7 TRCN0000200021 CAGGCCAATTTGGACCTCATT pLKO.1 756 CDS 100% 4.950 3.465 N Ndrg3 n/a
8 TRCN0000278985 CAGGCCAATTTGGACCTCATT pLKO_005 756 CDS 100% 4.950 3.465 N Ndrg3 n/a
9 TRCN0000200457 GAGCCTACATTCTCAGCAGAT pLKO.1 577 CDS 100% 4.050 2.835 N Ndrg3 n/a
10 TRCN0000200080 CCACAGCATCTCTCTCTAGTA pLKO.1 1396 3UTR 100% 4.950 2.970 N Ndrg3 n/a
11 TRCN0000279054 CCACAGCATCTCTCTCTAGTA pLKO_005 1396 3UTR 100% 4.950 2.970 N Ndrg3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_013865.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.